The Transposon Registry

Displaying 1781 - 1800 of 2189
Tn7472
Avery Roberts
Tn7473
Avery Roberts
Tn7474
Avery Roberts
Tn7475
Avery Roberts
Tn7476
Avery Roberts
Tn7477
Avery Roberts
Tn7478
Avery Roberts
Tn7479
Avery Roberts
Tn7480
Avery Roberts
Tn7481
associated professor Min Yuan
Contact
Tn7482
Prof Dongsheng Zhou
Tn7483
Prof Dongsheng Zhou
Tn7484
Prof Dongsheng Zhou
Tn7485
Prof Dongsheng Zhou
Tn7486
Prof Dongsheng Zhou
Tn7487
Prof Dongsheng Zhou
Tn7488
Prof Dongsheng Zhou
Tn7489
Dr Nick Coleman
University of Sydney
  • Antispetic Resistance
Characteristics
Tn7489 is a 6921 bp transposon in the Tn3 family that is closely related (90% aa identity in the transposase) to the previously identified element TnEc1 (Genbank #HE603113). While previous literature disagreed on whether TnEc1 should be defined as an 'insertion sequence' or a 'transposon', it is clear that Tn7489 is genuinely a transposon, since it carries cargo genes in addition to the transposase and resolvase. Tn7489 encodes a 994 aa DDE transposase, which has been inactivated by a stop codon at position 252 in the example present in our particular bacterial isolate (Pantoea sp from equine faecal sample), but the transposase gene is intact in most of its close homologs in Genbank. The transposon has a 212 aa resolvase (serine recombinase) and 47 bp near-perfect inverted repeats. A high AT region is present between the tnpA and tnpR genes which is likely to be the res site. Tn7489 carries four cargo genes (frmR, frmA, gloA, frmB) which are organised as a single operon. These genes are all predicted to encode enzymes for detoxification of reactive aldehydes (e.g. formaldehyde), and thus we believe Tn7489 to be one of the first reported examples of a formaldehyde resistance transposon.
References

publication and genbank entry coming soon

Contact
Tn7490
Humberlania Duarte
Tn7491
Dr Joshua Ramsay
Curtin University
  • Antibiotic Resistance
  • Trimethoprim
Characteristics
Tn7491 is a ~3.3kb transposon carrying the trimethoprim-resistance gene dfrG (1) and was first identified inserted into a variant of Tn916 present in Listeria monocytogenes, named Tn6198 (2). A copy of Tn7491 is also present within a variant of the methicillin-resistance element, staphylococcal cassette chromosome mec type IVo, present in some sequence-type 5 (ST5) Staphylococcus aureus (3). Tn7491 is flanked by 9-basepair direct repeat sequence (GTAAAAATA in L. monocytogenes; GGTAAAGAA in S. aureus) formed from a target-site duplication. Tn7491 is also present in S. epidermidis strain C99 (accession CP094859, coordinates 2,016,817 - 2,020,092) flanked by a 9-bp direct repeat sequence CCTTCATAA. In all three examples, the inverted-repeat sequence TAAGTAGTTCAGTTTTGGAGTACAAAA borders the ends of Tn7491. In addition to the dfrG gene, two putative open-reading frames are present, orfU2 and orfU1 (2). Search results from the DALI server (4) using an alphafold2-generated structural model (5,6) of the OrfU1 polypeptide as a query reveals some similarity to the transposase of the IS256-family (7) insertion sequence ISCth4 (8)(PDB 6xgx). The author makes no claim to the discovery of Tn7491.
References

1. Sekiguchi, J., Tharavichitkul, P., Miyoshi-Akiyama, T., Chupia, V., Fujino, T., Araake, M., Irie, A., Morita, K., Kuratsuji, T. and Kirikae, T. (2005) Cloning and characterization of a novel trimethoprim-resistant dihydrofolate reductase from a nosocomial isolate of Staphylococcus aureus CM.S2 (IMCJ1454). Antimicrob Agents Chemother, 49, 3948-3951.
2. Bertsch, D., Uruty, A., Anderegg, J., Lacroix, C., Perreten, V. and Meile, L. (2013) Tn6198, a novel transposon containing the trimethoprim resistance gene dfrG embedded into a Tn916 element in Listeria monocytogenes. J Antimicrob Chemother, 68, 986-991.
3. McGuinness, S.L., Holt, D.C., Harris, T.M., Wright, C., Baird, R., Giffard, P.M., Bowen, A.C. and Tong, S.Y.C. (2021) Clinical and Molecular Epidemiology of an Emerging Panton-Valentine Leukocidin-Positive ST5 Methicillin-Resistant Staphylococcus aureus Clone in Northern Australia. mSphere, 6.
4. Holm, L. (2020) Using Dali for Protein Structure Comparison. Methods Mol Biol, 2112, 29-42.
5. Jumper, J., Evans, R., Pritzel, A., Green, T., Figurnov, M., Ronneberger, O., Tunyasuvunakool, K., Bates, R., Zidek, A., Potapenko, A., Bridgland, A., Meyer, C., Kohl, S.A.A., Ballard, A.J., Cowie, A., Romera-Paredes, B., Nikolov, S., Jain, R., Adler, J., Back, T., Petersen, S., Reiman, D., Clancy, E., Zielinski, M., Steinegger, M., Pacholska, M., Berghammer, T., Bodenstein, S., Silver, D., Vinyals, O., Senior, A.W., Kavukcuoglu, K., Kohli, P. and Hassabis, D. (2021) Highly accurate protein structure prediction with AlphaFold. Nature, 596, 583-589.
6. Mirdita, M., Schütze, K., Moriwaki, Y., Heo, L., Ovchinnikov, S. and Steinegger, M. (2021) ColabFold - Making protein folding accessible to all. bioRxiv, 2021.2008.2015.456425.
7. Lyon, B.R., Gillespie, M.T. and Skurray, R.A. (1987) Detection and characterization of IS256, an insertion sequence in Staphylococcus aureus. J Gen Microbiol, 133, 3031-3038.
8. Kosek, D., Hickman, A.B., Ghirlando, R., He, S. and Dyda, F. (2021) Structures of ISCth4 transpososomes reveal the role of asymmetry in copy-out/paste-in DNA transposition. EMBO J, 40, e105666.

Accession number
Contact

Pages